Cracking the Case: A Forensic DNA Mystery

This blog post is about a Saturday DNA class where we had to crack a forensic code! The case was a robbery with multiple suspects, and the only way to figure out who did it was to move through seven different stations, collecting clues and evidence along the way. Each station gave us new information, and we had to piece everything together like real forensic scientists. It was honestly really fun and felt like solving a real crime.

Station 1: Analyzing the Crime Scene

We started by examining the crime scene details. This station helped set up the case by showing what happened, what was taken, and what kinds of evidence were left behind. It gave us our first clues and helped us understand what we should be looking for as we moved through the other stations.

Station 2: Fingerprint Analysis (Part 1)

At this station, we looked at DNA fingerprints and matched them to different suspects. We had to figure out whose fingerprints were found on specific objects at the crime scene. This helped narrow down who had actually been present during the robbery.

Station 3: Fingerprint Analysis (Part 2)

This station continued the fingerprint investigation. We compared more DNA fingerprint patterns to see which suspects matched the evidence. Seeing how unique each fingerprint pattern was made it clear why fingerprints are such strong forensic evidence.

Station 4: Measuring Physical Evidence

Here, we measured the height, foot length, and arm length based on the prints the robber left behind. Using these measurements, we were able to narrow the suspects down to two possible people. It was cool to see how math and biology can work together to solve a crime.

Station 5: DNA Ladder Comparison

At this station, we examined a DNA evidence ladder and compared it to DNA ladders from the suspects. By matching the band patterns, we could see whose DNA appeared on items from the crime scene. This station felt the most like real lab work.

Station 6: DNA Sequence Matching

This was one of the most detailed stations. We looked at an actual DNA sequence (ATCGGATTACTTAGCATGCATGCAATGC) and compared it to the suspects’ DNA sequences. Matching the letters helped confirm whose DNA was present, showing how precise DNA evidence can be.

Station 7: Final Conclusion

In the final station, we put everything together. We had to write down who we thought the suspect was, the motive, and the key evidence that proved it. Based on all the clues from the seven stations, my original guess was Jon — and I was right!

Final Thoughts

This forensic DNA lab was one of the most fun science activities I’ve done! Moving through the stations made it feel like a real investigation, and using multiple types of evidence showed how science helps solve crimes. It was exciting to see all the clues connect and even better to find out my guess was correct!

Shoutout!

I want to give a shout out to the Cold Spring Harbor Learning Center for hosting such an exciting event! I also want to thank the instructor Mrs. Brittany Johnson - you did a great job teaching this class!(if you want to check her out, here is her bio: Brittany Johnson)